Guía UNAM LCG | Módulo de Biología de Ciencias Genómicas

Si vas a presentar el examen a la licenciatura en ciencias genómicas de la modalidad de ingreso indirecto, en este artículo vamos a resolver la guía del examen de admisión interno en el módulo de biología.

UNAM-Cs-GENÓMICAS

Recuerda que para ingresar a esta licenciatura es necesario que primero apliques a la convocatoria vigente, y resultes seleccionado en alguna de las carreras de origen, puedes aplicar a cualquier carrera del área I o II.

Requisitos de ingreso:

  • Completar la solicitud de registro en el portal e instancias oficiales.
  • Presentar un examen de conocimientos y obtener un resultado satisfactorio, las áreas que se evalúan son matemáticas, química y biología.
  • Entrevista personal con comité evaluador.

La licenciatura se oferta en el centro de ciencias genómicas y en la Escuela Nacional de Estudios Superiores Juriquilla.

Consulta los otros temas del examen:

Reactivo 1

Entramado de túbulos membranosos sin ribosomas que participan en el transporte celular, en la síntesis de lípidos, en procesos de detoxificación y actúa como reservorio de Ca2+

  1. Los Centrosomas
  2. Membrana citoplásmica
  3. Mitocondria
  4. Retículo Endoplásmico Rugoso
  5. Retículo Endoplásmico liso

Solución:

El retículo endoplasmático o RE es una red de membranas ubicadas cerca del núcleo celular. Tiene forma de sacos aplanados o túbulos y su extensión es tanta que constituye casi el 50% de todas las superficies membranosas dentro de la célula.

Existen dos tipos de RE que difieren en estructura y función: liso y rugoso.

El retículo endoplasmático rugoso se encuentra junto a la membrana nuclear, en estrecha cercanía. Su estructura es en forma de sacos aplanados y su ubicación es estratégica para recibir el ARNm que contiene la información necesaria para ser traducida y convertida a proteínas. Todo ello es posible gracias a la presencia de ribosomas, que se encuentra revistiendo la superficie del RE y es el lugar exacto en donde se lleva a cabo la síntesis proteica.

En contraste, el RE liso se extiende desde el RE rugoso para dar origen a una red de túbulos membranosos. La superficie del REL está desprovista de ribosomas, ya que en él cumple funciones un poco más diversas.

El REL se encarga de la síntesis de ácidos grasos y esteroides como estrógenos y testosterona. Además, el REL de los hepatocitos contiene enzimas que facilitan la liberación de glucosa al torrente sanguíneo y contribuye a detoxificar el organismo de fármacos liposolubles o sustancias nocivas para la salud.

Asimismo, el REL en las células musculares, el retículo sarcoplasmático (una variante del REL), se encarga de almacenar y liberar iones calcio para estimular la contracción muscular.

En base a la justificación teórica – funcional, la respuesta correcta es la opción E.

Aparta tu lugar al primer grupo con 50% OFF

Curso UNAM 2025

Acceso total durante x12 meses
El curso cubre todos los temas del examen de admisión con clases en vivo y examenes simulacro.
Código: UNAM120
$4,000 MX
$2,000 MXN

Reactivo 2

Durante la fase G2 del ciclo celular, en una célula de un hombre, la información genética en el núcleo se encuentra organizada en la siguiente forma:

  1. 22 autosomas, 1 cromosoma X y 1 cromosoma Y
  2. 44 autosomas y 2 cromosomas X
  3. 22 autosomas duplicados, 1 cromosoma X duplicado y 1 cromosoma Y duplicado
  4. 44 autosomas duplicados, 1 cromosoma X duplicado y 1 cromosoma Y duplicado
  5. 44 autosomas, 1 cromosoma X y 1 cromosoma Y

Solución:

Casi todas las células de nuestro organismo experimentan división celular, para recambiarse o ser renovadas constantemente. El ciclo celular explica la secuencia de pasos ordenados mediante el cual las células somáticas se dividen.

La mayoría de las células de nuestro cuerpo, como las neuronas, los hepatocitos, las células estomacales, y muchas más (excluyendo las células sexuales), tiene 23 pares de cromosomas, es decir, un total de 46 cromosomas. De manera específica 22 pares de cromosomas son autosomas y 1 par corresponde a los cromosomas sexuales: XX para la mujer y XY para el hombre.

Cuando una célula se divide, todos sus cromosomas se duplican para que la información genética pase a las células hijas. El ciclo celular abarca diferentes períodos como: interfase y fase mitótica.

La interfase comprende diferentes etapas de gran actividad metabólica para la célula. En sus fases G1 y S, se duplican los organelos citosólicos y el ADN se replica.

En la fase G2 de la interfase continúa el crecimiento celular para dar origen a la mitosis. Pero, en este punto el ADN se encuentra completamente replicado, lo que quiere decir que existe 44 autosomas duplicados, 1 cromosoma X duplicado y 1 cromosoma Y duplicado, si se trata de una persona de sexo masculino.

La respuesta correcta es la opción D.

Reactivo 3

El intercambio de información genética entre las cromátidas hermanas se realiza durante la siguiente fase de la meiosis:

  1. Antes de la profase de la primera división meiótica
  2. Metafase de la primera división meiótica
  3. Entre la primera y la segunda división meiótica
  4. Profase de la segunda división meiótica
  5. Metafase de la segunda división meiótica

Solución:

La meiosis comprende la división celular de las células sexuales. Sucede en dos etapas: meiosis I y meiosis II. Durante el proceso la carga cromosómica se reduce a la mitad y existe un entrecruzamiento de la información genética.

Durante la interfase, previo a la meiosis I, los cromosomas de la célula diploide se han duplicado. A raíz de dicha duplicación, cada cromosoma cuenta con dos cromátides hermanas genéticamente idénticas, las cuales se aparean por un proceso denominado sinapsis.

Como resultado se obtiene una estructura denominada tétrada en donde va a ocurrir un intercambio de información genética de distintos sectores de los cromosomas homólogos de cromátides no hermanas denominado, entrecruzamiento.

En este sentido, el intercambio de información genética entre las cromátidas hermanas se realiza antes de la profase de la primera división meiótica. La respuesta correcta es la opción A.

Reactivo 4

En la primera reacción de la glucólisis catalizada por la Hexoquinasa:

D·Glucosa + ATP→ D·Glucosa-6-fosfato + ADP

¿Qué efecto produce la adición de L-Glucosa a la reacción?

  1. Un aumento en la concentración de la D·Glucosa-6-fosfato
  2. Una inhibición no-competitiva
  3. Una inhibición competitiva
  4. Una inhibición alostérica
  5. Una activación alostérica

Solución:

Las enzimas y sus sustratos se unen de forma no covalente a nivel del sitio activo de la enzima.

El sitio activo es un área de gran especificidad por su sustrato. Pero, si existe una molécula muy parecida al sustrato, la enzima aceptará esta molécula en su lugar de unión y se producirá una competencia entre el sustrato y la molécula similar para encajar en el sitio activo.

Esto es lo que sucede con la L-glucosa, aunque el sustrato de la hexoquinasa es la D-glucosa, la L-glucosa es una molécula de gran semejanza que puede unirse de forma competitiva a la enzima y desplazar al sustrato. Estado denominado: inhibición competitiva.

En este sentido, la opción correcta es la C.

Reactivo 5

Una vía catabólica (que genera energía química) está constituida por una serie de reacciones, catalizadas enzimáticamente i. e. la Glucólisis ¿Qué podemos decir del producto final comparado con el sustrato inicial?

  1. Que está más hidratado
  2. Que está más reducido
  3. Que está más oxidado
  4. Que está más saturado
  5. Que es más grande

Solución:

La glicólisis es una vía catabólica en la que se oxida la glucosa para generar, piruvato, ATP y equivalentes reductores que se transformarán en energía por fosforilación oxidativa.

Por lo tanto, el producto final es un compuesto más oxidado en relación a la molécula de glucosa inicial.

La respuesta correcta es la opción C.

Reactivo 6

Indique qué moléculas son producidas durante la glucólisis (de 1 molécula de glucosa hasta 2 de piruvato)

  1. 2ATP y 2NADH
  2. 2ATP y 1NADPH
  3. 1ATP, 2NADH y 1 FAD{H}_{2}
  4. 1ATP, 1NADH y 1NADPH
  5. 2ATP, 2NADPH y 2 FAD{H}_{2}

Solución:

La glicólisis es una ruta de gran importancia para el metabolismo celular. Se lleva a cabo en el citosol y la oxidación del piruvato se realiza en la mitocondria. El producto energético y de equivalentes reductores que se produce en esta vía metabólica genera 2ATP y 2NADH.

La respuesta correcta es la opción A.

Reactivo 7

Indique el tipo de moléculas acarreadoras de electrones que se producen en el ciclo de Krebs

  1. NADH/H+, NADPH/H+, FAD{H}_{2}
  2. NADH/H+, NADPH/H+
  3. NADPH/H+, FAD{H}_{2}
  4. NADH/H+, FAD{H}_{2}
  5. Solo NADH/H

Solución:

Los equivalentes reductores que se generan en el ciclo de Krebs son indispensables, ya que ellos viajan a la cadena respiratoria y por un proceso de fosforilación oxidativa se transforman en ATP.

Los equivalentes reductores generados en el ciclo de Krebs son NADH/H+ y FAD{H}_{2} .

La respuesta correcta es la opción D.

Reactivo 8

Si un nucleótido de un codón, es sustituido por otro ¿Cuál de los siguientes resultados es necesariamente falso?

  1. Que cambie el aminoácido codificado por dicho codón
  2. Que no cambie el aminoácido codificado por dicho codón
  3. Que cambie la fase de lectura a partir del codón modificado
  4. Que genere un codón de paro
  5. Que el cambio sea una transición

Solución:

El resultado falso que expone el enunciado es, que se genere un codón de paro. Cuando un nucleótido de un codón es sustituido por otro puede darse el cambio del aminoácido codificado por dicho codón o no varía el aminoácido. La fase de lectura también puede cambiar, pero de lleno no se puede generar un codón de paro.

Como el ARNm es invariablemente más largo que el marco de lectura abierto que se debe traducir, son necesarias las señales específicas que dan inicio y final a la traducción.

En casi todos los organismos se utilizan los codones UAA, UAG y UGA como señales de detención y no codifican ningún aminoácido.

La respuesta correcta es la opción D.

Reactivo 9

Indique el polipéptido codificado en la siguiente secuencia de RNA mensajero tomando en cuenta el inicio y fin de la traducción

5´-GGAA AUG AGG UCG AUC CCG UAG GG-3´

  1. Gly-Asn-Glu-Val-Asp-Val-Pro-Val-Gly
  2. Glu-Met-Arg-Ser-Ile-Pro- paro
  3. Met-Arg-Ser-Ile-Pro- paro
  4. Pro-Ile-Ser-Arg-Met- paro
  5. Gly-Arg-Ser-Arg-Arg- paro

Solución:

Para conocer el inicio de la traducción del ARNm es imprescindible recordar que se inicia con la secuencia AUG que codifica para el aminoácido metionina, por lo tanto, el polipéptido codificado comienza con el aminoácido metionina.

Esta información es una señal suficiente para evaluar que las otras opciones del enunciado se pueden descartar, ya que no siguen el orden de codificación establecido.

Por supuesto, la traducción del ARNm finaliza cuando se lee un codón de paro, los cuales pueden ser:

  • UAA
  • UAG
  • UGA

La respuesta correcta es la opción C.

Reactivo 10

Indique la cadena de DNA que sirvió como templado para transcribir esta cadena de RNA:

5´-AAGUAUGACCAACGGCUGAAA-3´

  1. 5´-TTCATACTGGTTGCCGACTTT-3´
  2. 5´-TTTCAGCCGTTGGTCATACTT-3´
  3. 5´-GGGACTAATGGTTGACGCAGG-3´
  4. 5´-UUUCAGCCGUUGGUCAUACUU-3´
  5. 5´-UUCAUACUGGUUGCCGACUUU-3´

Solución:

La complementariedad de las bases nitrogenadas es Adenina – Timina y Guanina – Citosina. En la cadena de ARN no existe la Timina, en su lugar se utiliza Uracilo.

Bases Nitrogenadas
ARNm
3^{'}\rightarrow 5^{'}
AAAGUCGGCAACCAGUAUGAA
Hebra molde de ADN
5^{'}\rightarrow 3^{'}
TTTCAGCCGTTGGTCATACTT

La opción que indica la complementariedad de las bases es la B.

Reactivo 11

En la cruza, de una pareja de una especie diploide, Aa Bb x Aa Bb (donde los alelos A y B se encuentran en cromosomas distintos y presentan dominancia simple) ¿Cuántos genotipos y fenotipos posibles se esperan para su progenie?

  1. 4 genotipos y 4 fenotipos
  2. 9 genotipos y 4 fenotipos
  3. 9 genotipos y 3 fenotipos
  4. 6 genotipos y 3 fenotipos
  5. 3 genotipos y 2 fenotipos

Solución:

Cuando se produce este tipo de cruce, podemos estudiar los genotipos y fenotipos generados:

Los progenitores pueden tener características o rasgos específicos que se heredarán en la descendencia según la combinación de los alelos dominantes y recesivos.

Aa Bb x Aa Bb

Como podemos observar existirán:

HERENCIA-MENDELIANA

  • 4 fenotipos, es decir cuadro cualidades visibles diferentes.
  • Y 9 genotipos diferentes: 1 AABB, 1 aabb,1 AAbb, 1 aaBB, 2 AABb, 2 AaBB, 2 Aabb, 2 aaBb, 4 AaBb.

Reactivo 12

En cierta raza de ganado vacuno (diploide) el color del pelo está genéticamente determinado y es monogénico, pudiendo ser Rojo (en homocigotos RR), Blanco (en homocigotos rr) o Canela (en heterocigotos Rr). Si un toro Rojo se cruza con una vaca Blanca y uno de sus descendientes se cruza con otra vaca Blanca ¿Cuántos fenotipos se pueden generar de esta última cruza y en qué proporciones aparecerán?

  1. 50% Blancos y 50% Canela
  2. 25% Blancos y 75% Canela
  3. 25% Blancos, 50% Canela y 25% rojos
  4. 100% Canela
  5. 75% Blancos, 25% Canela

Solución:

El cruce de un toro rojo (RR) con una vaca blanca (rr) genera una descendencia 100% canela (Rr).

Cuando se cruza un miembro de la descendencia (Rr) con una vaca (rr) blanca la descendencia será:

HERENCIA-MENDELIANA

50% de la descendencia tendrá el pelo color canela

50% de la descendencia tendrá el pelo color blanco

Respuesta correcta opción A.

Reactivo 13

¿Cuál de los siguientes explica correctamente como un rasgo genético favorable puede incrementar su frecuencia en la población?

  1. Principio de Lamarck
  2. La selección natural
  3. La radiación adaptativa
  4. La recombinación genética
  5. La segregación de alelos

Solución:

La selección natural es la base de la evolución, cuando se habla de adaptación para sobrevivir según las condiciones del entorno, quiere significar que el organismo presenta algunas variedades favorables que le permiten vivir, reproducirse y transmitir las variaciones adquiridas.

La respuesta correcta es la opción B.

Reactivo 14

Indique en cuál de los siguientes individuos existe evidencia de estar mejor adaptado en términos evolutivos

  1. Niña de 7 años que tiene 8 hermanos
  2. Mujer de 20 años que logró cruzar el canal de la mancha
  3. Mujer de 50 años con dos matrimonios y dos hijos en cada matrimonio
  4. Mujer joven con madre, abuela y bisabuela sanas
  5. Mujer de 90 años en buen estado de salud

Solución:

En términos evolutivos la persona que mejor se adapta es aquella que desarrolla condiciones genéticas que le permiten mantenerse a través de los años. En otras palabras, un avance en la fisiología (funcionamiento del organismo) brinda la capacidad de amoldarse a los cambios, aunque estos puedan ser bastante variables.

Dicha cualidad se observa en la mujer de 50 años que ha tenido dos matrimonios y dos hijos en cada uno de ellos. La situación denota que han sido cambios sociales y del entorno drásticos, que su cuerpo ha engendrado a cuatro seres vivos y que según las condiciones se ha adaptado a través de los años para reproducirse sin anomalías.